versprechen Destillation Alice 35s promoter sequence lila Minister rutschen
The cauliflower mosaic virus (CaMV) 35S promoter sequence alters the level and patterns of activity of adjacent tissue- and organ-specific gene promoters | SpringerLink
Addgene: pMpGWB106
CaMV35S promoter – A plant biology and biotechnology workhorse in the era of synthetic biology - ScienceDirect
Plants | Free Full-Text | A Core35S Promoter of Cauliflower Mosaic Virus Drives More Efficient Replication of Turnip Crinkle Virus
Tuning the Transcriptional Activity of the CaMV 35S Promoter in Plants by Single-Nucleotide Changes in the TATA Box | ACS Synthetic Biology
A 64-bp sequence containing the GAAGA motif is essential for CaMV-35S promoter methylation in gentian - ScienceDirect
The Cauliflower Mosaic Virus 35S Promoter Extends into the Transcribed Region | Journal of Virology
Functional Characterization of a Strong Bi-directional Constitutive Plant Promoter Isolated from Cotton Leaf Curl Burewala Virus | PLOS ONE
Addgene: pP35S (GB0030)
a) Modular organization of the cauliflower mosaic virus 35S (35S)... | Download Scientific Diagram
Part:BBa K1825004 - parts.igem.org
PDF] Expression analysis of the 35S CaMV promoter and its derivatives in transgenic hairy root cultures of cucumber (Cucumis sativus) generated by Agrobacterium rhizogenes infection | Semantic Scholar
Tuning the Transcriptional Activity of the CaMV 35S Promoter in Plants by Single-Nucleotide Changes in the TATA Box | ACS Synthetic Biology
Development of a general method for detection and quantification of the P35S promoter based on assessment of existing methods | Scientific Reports
Bidirectionalization of polar promoters in plants | Nature Biotechnology
You're eating viral DNA? - Biology Fortified Inc.
Promoters
Addgene
Sequencing data for MON810 35S promoter to show LAMP primer positions.... | Download Scientific Diagram
Plants | Free Full-Text | Evaluation of Plant-Derived Promoters for Constitutive and Tissue-Specific Gene Expression in Potato
11
Domains of the CaMV 35S promoter (Benfey et al., 1990) and enhanced... | Download Scientific Diagram
Solved Here the 203bp CaMV 35S promoter sequence that you | Chegg.com
The Use of 35S and Tnos Expression Elements in the Measurement of Genetically Engineered Plant Materials
Name of Primer Sequence (5' - 3') 35S promoter primer forward AGGAAACAGCTATGACCATG reverse GAACTTCCTTATATAGAGGAAGG actin primer
Name of Primer Sequence (5' - 3') 35S promoter primer forward AGGAAACAGCTATGACCATG reverse GAACTTCCTTATATAGAGGAAGG actin primer