Home

versprechen Destillation Alice 35s promoter sequence lila Minister rutschen

The cauliflower mosaic virus (CaMV) 35S promoter sequence alters the level  and patterns of activity of adjacent tissue- and organ-specific gene  promoters | SpringerLink
The cauliflower mosaic virus (CaMV) 35S promoter sequence alters the level and patterns of activity of adjacent tissue- and organ-specific gene promoters | SpringerLink

Addgene: pMpGWB106
Addgene: pMpGWB106

CaMV35S promoter – A plant biology and biotechnology workhorse in the era  of synthetic biology - ScienceDirect
CaMV35S promoter – A plant biology and biotechnology workhorse in the era of synthetic biology - ScienceDirect

Plants | Free Full-Text | A Core35S Promoter of Cauliflower Mosaic Virus  Drives More Efficient Replication of Turnip Crinkle Virus
Plants | Free Full-Text | A Core35S Promoter of Cauliflower Mosaic Virus Drives More Efficient Replication of Turnip Crinkle Virus

Tuning the Transcriptional Activity of the CaMV 35S Promoter in Plants by  Single-Nucleotide Changes in the TATA Box | ACS Synthetic Biology
Tuning the Transcriptional Activity of the CaMV 35S Promoter in Plants by Single-Nucleotide Changes in the TATA Box | ACS Synthetic Biology

A 64-bp sequence containing the GAAGA motif is essential for CaMV-35S  promoter methylation in gentian - ScienceDirect
A 64-bp sequence containing the GAAGA motif is essential for CaMV-35S promoter methylation in gentian - ScienceDirect

Strategies to mitigate transgene–promoter interactions - Gudynaite‐Savitch  - 2009 - Plant Biotechnology Journal - Wiley Online Library
Strategies to mitigate transgene–promoter interactions - Gudynaite‐Savitch - 2009 - Plant Biotechnology Journal - Wiley Online Library

8
8

The Cauliflower Mosaic Virus 35S Promoter Extends into the Transcribed  Region | Journal of Virology
The Cauliflower Mosaic Virus 35S Promoter Extends into the Transcribed Region | Journal of Virology

Functional Characterization of a Strong Bi-directional Constitutive Plant  Promoter Isolated from Cotton Leaf Curl Burewala Virus | PLOS ONE
Functional Characterization of a Strong Bi-directional Constitutive Plant Promoter Isolated from Cotton Leaf Curl Burewala Virus | PLOS ONE

Addgene: pP35S (GB0030)
Addgene: pP35S (GB0030)

a) Modular organization of the cauliflower mosaic virus 35S (35S)... |  Download Scientific Diagram
a) Modular organization of the cauliflower mosaic virus 35S (35S)... | Download Scientific Diagram

Part:BBa K1825004 - parts.igem.org
Part:BBa K1825004 - parts.igem.org

PDF] Expression analysis of the 35S CaMV promoter and its derivatives in  transgenic hairy root cultures of cucumber (Cucumis sativus) generated by  Agrobacterium rhizogenes infection | Semantic Scholar
PDF] Expression analysis of the 35S CaMV promoter and its derivatives in transgenic hairy root cultures of cucumber (Cucumis sativus) generated by Agrobacterium rhizogenes infection | Semantic Scholar

Tuning the Transcriptional Activity of the CaMV 35S Promoter in Plants by  Single-Nucleotide Changes in the TATA Box | ACS Synthetic Biology
Tuning the Transcriptional Activity of the CaMV 35S Promoter in Plants by Single-Nucleotide Changes in the TATA Box | ACS Synthetic Biology

Development of a general method for detection and quantification of the  P35S promoter based on assessment of existing methods | Scientific Reports
Development of a general method for detection and quantification of the P35S promoter based on assessment of existing methods | Scientific Reports

Bidirectionalization of polar promoters in plants | Nature Biotechnology
Bidirectionalization of polar promoters in plants | Nature Biotechnology

You're eating viral DNA? - Biology Fortified Inc.
You're eating viral DNA? - Biology Fortified Inc.

Promoters
Promoters

Addgene
Addgene

Sequencing data for MON810 35S promoter to show LAMP primer positions.... |  Download Scientific Diagram
Sequencing data for MON810 35S promoter to show LAMP primer positions.... | Download Scientific Diagram

Plants | Free Full-Text | Evaluation of Plant-Derived Promoters for  Constitutive and Tissue-Specific Gene Expression in Potato
Plants | Free Full-Text | Evaluation of Plant-Derived Promoters for Constitutive and Tissue-Specific Gene Expression in Potato

11
11

Domains of the CaMV 35S promoter (Benfey et al., 1990) and enhanced... |  Download Scientific Diagram
Domains of the CaMV 35S promoter (Benfey et al., 1990) and enhanced... | Download Scientific Diagram

Solved Here the 203bp CaMV 35S promoter sequence that you | Chegg.com
Solved Here the 203bp CaMV 35S promoter sequence that you | Chegg.com

The Use of 35S and Tnos Expression Elements in the Measurement of  Genetically Engineered Plant Materials
The Use of 35S and Tnos Expression Elements in the Measurement of Genetically Engineered Plant Materials

Name of Primer Sequence (5' - 3') 35S promoter primer forward  AGGAAACAGCTATGACCATG reverse GAACTTCCTTATATAGAGGAAGG actin primer
Name of Primer Sequence (5' - 3') 35S promoter primer forward AGGAAACAGCTATGACCATG reverse GAACTTCCTTATATAGAGGAAGG actin primer

Name of Primer Sequence (5' - 3') 35S promoter primer forward  AGGAAACAGCTATGACCATG reverse GAACTTCCTTATATAGAGGAAGG actin primer
Name of Primer Sequence (5' - 3') 35S promoter primer forward AGGAAACAGCTATGACCATG reverse GAACTTCCTTATATAGAGGAAGG actin primer