Origination of the Split Structure of Spliceosomal Genes from Random Genetic Sequences | PLOS ONE
Splice variation| Oxford Nanopore Technologies
Predicting Splicing from Primary Sequence with Deep Learning
A computational analysis of sequence features involved in recognition of short introns | PNAS
IJMS | Free Full-Text | Non-Canonical Splicing and Its Implications in Brain Physiology and Cancer
Giardia lamblia Hsp90 pre‐mRNAs undergo self‐splicing to generate mature RNA in an in vitro trans‐splicing reaction - Iyer - 2019 - FEBS Letters - Wiley Online Library
Solved Sequence 1: 5' TAGGTGAAAGAGTAGCCTAGAATCAGTTA 3' | Chegg.com
Non-canonical splice junction processing increases the diversity of RBFOX2 splicing isoforms - ScienceDirect
Recognition of splice-junction genetic sequences using random forest and Bayesian optimization | SpringerLink
Ultra-deep sequencing reveals pre-mRNA splicing as a sequence driven high-fidelity process | PLOS ONE
Branch Point Identification and Sequence Requirements for Intron Splicing in Plasmodium falciparum | Eukaryotic Cell
IMGT Education
GitHub - drusk/splice-junction-gene-sequences: Recognizes, given a sequence of DNA, the boundaries between exons (the parts of the DNA sequence retained after splicing) and introns (the parts of the DNA sequence that are
Is PRNP mRNA alternatively spliced?
Consensus sequences and frequencies of human splice site... | Download Scientific Diagram
Nucleotide sequence at the splice junction sequences and sizes of exons... | Download Table
New connections between splicing and human disease: Trends in Genetics
Splice Sites (Molecular Biology)
Splicing-out of intron-equivalents
RNA splicing - Wikipedia
Splice junction site sequence logos of PtiICS in comparison with... | Download Scientific Diagram
A single m6A modification in U6 snRNA diversifies exon sequence at the 5' splice site | Nature Communications
Learning the Sequence Determinants of Alternative Splicing from Millions of Random Sequences - ScienceDirect
Introduction to RNA-seq sequencing: Preprocessing
