Engineering efficient termination of bacteriophage T7 RNA polymerase transcription | bioRxiv
Easy TA Cloning Vector
Customized one-step preparation of sgRNA transcription templates via overlapping PCR Using short primers and its application in vitro and in vivo gene editing | Cell & Bioscience | Full Text
What universal primer should I choose for plasmid sequencing? | ResearchGate
PCR amplification of HIV Integrase gene and synthesis of RNA... | Download Scientific Diagram
Introduction to DNA sequence
Standard Sequencing – 1st BASE
Improved Ligation-Mediated PCR Method Coupled with T7 RNA Polymerase for Sensitive DNA Detection | Analytical Chemistry
Addgene: pRS314-T7-GFP
Schematic of sgRNA synthesis and three-primer PCR strategies for... | Download Scientific Diagram
Maximizing transcription of nucleic acids with efficient T7 promoters | Communications Biology
sgRNA Synthesis Using the HiScribe™ Quick T7 High Yield RNA Synthesis Kit (NEB #E2050) | NEB
Sequencing Primers
A T7 autogene-based hybrid mRNA/DNA system for long-term shRNA expression in cytoplasm without inefficient nuclear entry | Scientific Reports
Transcriptional sequencing: A method for DNA sequencing using RNA polymerase | PNAS
Solved How can I design Forward and Reverse primer with this | Chegg.com
Improved Ligation-Mediated PCR Method Coupled with T7 RNA Polymerase for Sensitive DNA Detection | Analytical Chemistry
Data S2, Related to Figures 1-6 and S1-S12: Genes, Primer ID and sequences. Following is a list of all the genes, their primer I
Genes | Free Full-Text | Simple and Rapid Assembly of TALE Modules Based on the Degeneracy of the Codons and Trimer Repeats
Making RNA probes with T7 transcription - OpenWetWare
Table SI. Primers used in the NRAS sequencing. Primer name Primer sequence NRAS exon2 forward primer CAACAGGTTCTTGCTGGTGT NRAS e
Schematic representation of the two mimics construction steps. T7: T7... | Download Scientific Diagram
Addgene: T7 promoter + terminators reporter plasmid
Blockerette-Ligated Capture T7-Amplified RT-PCR, a New Method for Determining Flanking Sequences: Molecular Therapy
